adhesion invasion assay

Therefore, future experiments to examine the mechanisms by which paxillin may attenuate Salmonella invasion will provide more insight into the molecular regulation of this process. Note the bright actin puncta within the enlarged phagocytic structure. One important virulence characteristic of C. albicans is its cell surface hydrophobicity (CSH), due to the mannosylated surface proteins that cover the fungal cells. Interestingly, both FRNK and FAKY397F were able to restore Salmonella invasion as well as wild-type FAK (Figure 4B). Criss A. K., Ahlgren D. M., Jou T. S., McCormick B. Salmonella Together, these results identify a role for focal adhesion components in the Salmonella invasion process and provide new insight into the host signaling pathways utilized by the bacteria to facilitate their cellular invasion. Moreover, reconstitution of paxillin/ MEFs with wild-type paxillin resulted in bacterial invasion efficiency comparable with wild-type cells (Figure 8A). Alternatively, FAK and Cas may function in distinct pathways, and the FAK-dependent pathway may be sufficient to compensate for the lack of Cas when FAK is overexpressed. strains were grown in SD broth for 18 h and centrifuged at 4000 g for 10 min to obtain pellets for the subsequent cell counts in a hematocytometer. Cell migration can be monitored in real time by microscopy. Being a foodborne pathogen, it enters the blood stream in humans via intestines by crossing intestinal barriers. Cas binds to FAK through interaction of the N-terminal Cas SH3 domain with a proline-rich region (PXXP718) on FAK (Harte et al., 1996). Weidow C. L., Black D. S., Bliska J. Although only a small enhancement of coprecipitation was observed in cells infected with the noninvasive VV341 strain, infection with SL1344 robustly enhanced the interaction of p130Cas with both FAK and paxillin. In contrast, both Salmonella and Shigella enter cells by a trigger mechanism characterized by massive membrane ruffling and actin rearrangements at sites of invasion (Cossart and Sansonetti, 2004). At least 40 foci were measured. Finally, we show that overexpression of FAK in Cas/ cells completely restores Salmonella internalization, suggesting that FAK and Cas may act in concert to promote bacterial invasion. However, each of these processes is accompanied by increased tyrosine phosphorylation of FAK, indicative of its activation during particle internalization. Therefore, we sought to examine whether FAK and Cas function independently or if they cooperate to promote Salmonella invasion. Although phosphorylation of p130Cas is induced during Salmonella invasion, this is also not required for bacterial internalization. NO produced by fibroblasts in contact Candida albicans strains during adhesion and invasion assays. Epithelial cells and fibroblasts are the primary components of the oral mucosa and any injury to these cells may lead to the development of oral diseases, such as candidiasis or periodontal disease [21]. Figure 1B shows that a small amount of FAK and no detectable paxillin coprecipitated with Cas in uninfected cells. The gingival pocket and gingival crevicular fluid were found to be favorable environments for germination and hyphal growth of C. albicans. Other focal adhesion components, including vinculin, -actinin, and VASP also accumulated at bacterial invasion foci (unpublished data). (C) Quantification of Salmonella internalization as measured using the two-color immunofluorescence invasion assay. In contrast, and in agreement with our observations in MDCK cells, 1 integrin did not accumulate around invading bacteria (unpublished data). FAK+/+cells were used as a positive control. Invasive yeasts were analyzed to determine their CFU/ml. 296, No. Mean (standard deviation) of values obtained for hydrophobicity of Candida albicans strains, and the adhesion and invasion of these strains in fibroblasts. Expression levels of Cas in these cells were detected using a Cas mAb 8G4. Use 30 l from step B3 for infections with Caco-2 cells. An index of internalization is defined relative to the number of intracellular bacteria per cell in wild-type MEFs (this value is set equal to 1). Huang J., Hamasaki H., Nakamoto T., Honda H., Hirai H., Saito M., Takato T., Sakai R. Differential regulation of cell migration, actin stress fiber organization, and cell transformation by functional domains of Crk-associated substrate. (A) Cas+/+ and Cas/ cells were infected with wild-type S. typhimurium (SL1344) for 20 min before fixation, and F-actin was stained using FITC-conjugated phalloidin (green). Using Microsoft excel plot a bar graph for adhesion assay(. Bacterial internalization was determined as number of intracellular bacteria per cell. The invasion defect in Cas/ cells can be suppressed by overexpression of FAK, suggesting a functional link between FAK and Cas in the regulation of Salmonella invasion. Reddy S., Akgul A., Karsi A., Abdelhamed H., Wills R. W. and Lawrence M. L.(2016). The objectives of this study were to evaluate the ability of C. albicans isolates from periodontal pockets of patients with chronic periodontitis and diabetes to adhere to and invade gingival human fibroblasts in culture, to compare these same capabilities relative to the hydrophobicity of the isolates, and to measure the nitric oxide concentration (NO) produced by fibroblast cells in the presence of these yeasts. The mean percentage for hydrophobicity was statistically different between the HH (68%) and LH (3%) groups (Table 1). For each time point use one plate. Although Cas phosphorylation is not essential for Salmonella internalization, we found that cells lacking Cas were severely impaired in bacterial uptake. Images were taken at 100 magnification on a Nikon C1 confocal microscope. For the experimental studies, GF cells were cultured in 25 cm2 tissue culture flasks (Corning Inc., Corning, NY, USA) at 37C in an atmosphere of 5% CO2. However, the host molecules targeted by these effectors remain poorly defined. Only a few species of microorganisms normally found in diseased gingival pockets can penetrate the epithelia surface and provoke inflammation. Remove the vial from the water bath as soon as the contents are thawed, and decontaminate by dipping in or spraying with 70% ethanol. Check cells for contamination and confluency every 48 h. When 80% of the flask surface is covered by cells, they are ready for passaging (. Bruce-Staskal P. J., Weidow C. L., Gibson J. J., Bouton A. H. Cas, Fak and Pyk2 function in diverse signaling cascades to promote, Tyrosine phosphorylation of focal adhesion kinase at sites in the catalytic domain regulates kinase activity: a role for Src family kinases, The invasion-associated type-III protein secretion system in, Bacterial invasion: the paradigms of enteroinvasive pathogens. To determine whether the tyrosine phosphorylation state of FAK changes during Salmonella invasion, we immunoprecipitated FAK from MDCK cells infected apically with SL1344 or the noninvasive strain VV341 for 20, 40, or 60 min and then blotted with an anti-phosphotyrosine antibody, 4G10. Pipetting also helps in breaking mammalian cells. To examine the relationship between FAK and Cas in the context of bacterial invasion, we overexpressed wild-type Cas in FAK/ cells or FAK in Cas/ cells and measured internalization efficiency. Changes in the environmental conditions can trigger the formation of hyphae. (B) Frequency of focus formation in Cas+/+ and Cas/ cells was determined as described Figure 3A. 9-10, 13 April 2016 | Journal of Antimicrobial Chemotherapy, Vol. Cells were infected with SL1344 at a MOI = 30 for 1 h, and bacterial invasion was quantified using the two-color immunofluorescence assay. 47, 14 December 2014 | Cellular Microbiology, Vol. Figure 2. During adhesion assay the cells are incubated with listeria for 30 min but in invasion assay the cell growth is arrested at several time points after infection to monitor the growth and survival rate of listeria in cells. 2A). Ozeri V., Rosenshine I., Ben-Ze'Ev A., Bokoch G. M., Jou T. S., Hanski E. De novo formation of focal complex-like structures in host cells by invading. For the control group, the cells were not submitted to washing with PBS and incubation with nistatin. In contrast, this pattern did not occur in cells infected with the noninvasive strain VV341, suggesting that the observed changes were due to secreted effector proteins. Together, these data indicate that although tyrosine phosphorylation of Cas is substantially elevated during Salmonella invasion, this modification appears to be dispensable for bacterial entry. All the steps are done aseptically or in sterile conditions during this experiment, thus only one type of colonies (regular, round bacterial colonies) or no colonies should be observed on the plates. *p < 0.001 (Student's t test). The role of C. albicans in periodontal disease is not clear and further studies are needed to demonstrate the clinical significance of the findings. The protocol in this articles describes the procedures to grow Caco-2 cells, maintain cells and use them for adhesion and invasion assays. This is likely due to aberrant assembly of the phagocytic apparatus, which in Cas null cells was characterized by its large size and the presence of numerous distinct actin patches. For instance, integrin v5mediated internalization of spent photoreceptor outer segment fragments by retinal pigment epithelium requires FAK (Finnemann, 2003). (B) MDCK cells were infected apically with SL1344 or the invasion-defective mutant VV341 at a MOI = 100 for 30 min. The primers correspond to a portion of the gene AAT1a (ID 3643468) F: 5 ACTGCTCAAACCATCTCTGG 3 and R: 5 CACAAGGCAAATGAAGGAAT 3 with fragment size of 472bp. The .gov means its official. Transfected cells were labeled with 9E10 followed by a Cy2-conjugated donkey anti-mouse secondary antibody. 37, 13 September 2012 | Molecular Diagnosis & Therapy, Vol. The concentration of NO produced by gingival fibroblasts after 2 (adhesion) and 4 h (invasion) of incubation with C. albicans was measured by the quantification of nitrite, a stable conversion product of NO. 15, No. It is therefore likely that binding of some other, unidentified protein(s) to the substrate-binding domain mediates the effects of Cas on assembly of the actin cytoskeleton. Three wells were uninfected or untreated and three wells were infected with cEMEM sans bacteria and acted as negative controls (NC1 and NC2). Centrifuge the plates briefly for 45 sec and incubate them at 37 C for 30 min. MDCK cells were infected at an MOI = 100 with S. typhimurium strain SL1344 or VV341 for 30 min. Figure 9. In the present study, both processes were successfully assessed using fibroblasts. Surprisingly, our reconstitution experiments indicate that bacterial entry requires the Cas-binding domain of FAK, but not the SH3 domain of Cas, (Figures 4B and 6C). The mouse monoclonal anti-FAK antibody clone 4.47 and anti-phospho-tyrosine antibody 4G10 were obtained from Upstate Biotechnology (Lake Placid, NY). Shigella C. albicans has been isolated from periodontal pockets in different forms of periodontitis, especially in HIV-positive and diabetic patients [35]. MDCK cells were grown in DMEM with 4.5 g/l glucose, 10% FBS, 1 mM sodium pyruvate, and antibiotics in a 37C CO2 incubator. Use two plates for each time point to obtain data for six replicates. The current results show that CSH is an important, non-specific factor for C. albicans adhesion to and invasion of oral fibroblasts. MEFs were grown in DMEM with 4.5 g/l glucose, 10% FBS, and antibiotics in a 37C CO2 incubator. These authors observed that most of the tested Candida strains had significantly more adherence to gingival epithelial cells than other types of fibroblasts. 6, No. CytoSelect ECM Cell Adhesion Assays quantify the adhesion of cells to one of a variety of extracellular matrix proteins. There was no difference between the HH and LH strains in the adhesion and invasion assays of the control groups (without treatments, trypsin for adhesion test or nistatin for invasion test) (p > 0.05). 1, 26 June 2019 | Frontiers in Cellular and Infection Microbiology, Vol. Although many studies have demonstrated that the adhesion process is related to bindings between host adhesins and mannoproteins of C. albicans, CSH seems to also play an important role in this process [17]. In contrast, expression of FAK in Cas/ cells completely restored Salmonella internalization. (B) Quantification of ruffle size in Cas+/+ and Cas/ cells; n = 40. Data concerning adhered and invasive C. albicans were analyzed using ANOVA and statistical differences among the groups, according to hydrophobicity, and were determined using Tukey's post hoc. Our results reveal that both FAK and p130Cas have essential, but novel functions in Salmonella internalization. Quantitation is performed using a fluorescent plate reader. To determine if any of these binding partners is necessary for Salmonella invasion, we analyzed bacterial internalization in FAK/ cells transfected with a panel of FAK mutants: FAK P715A, which largely attenuates binding to Cas (Polte and Hanks, 1995; Harte et al., 1996); FAK P878A, which impairs binding to ASAP1 and GRAF1 (Taylor et al., 1998; Randazzo et al., 2000; Liu et al., 2002); or FAK I937/999E, which reduces binding to paxillin (K. H. Martin and J. T Parsons, unpublished observation). The presence of this molecule in periodontal disease may reflect the involvement of an additional mediator in the regulation of bone resorption related to the progression of the disease [23]. One possibility is that one or more of the secreted bacterial effector proteins binds Cas via this domain and that this interaction is required for efficient Salmonella uptake. In contrast to FAK+/+ cells, where actin foci were robustly induced, focus formation was reduced by 80% in FAK/ cells (Figure 3A). For the invasion assays, the experiments were repeated but after 4 h of contact fibroblastsyeasts the unattached yeasts were removed by washing the wells three times with PBS and killed by incubation in RPMI containing 0.2 g/ml nistatin (Sigma) for 30 min. Some of these proteins allow the yeast to adhere to the host cells through the increase in hyphal forms and resistance against macrophages, both of which are essential for the establishment of chronic lesions. Human colon adenocarcinoma cells, Caco-2 cells have been used extensively as a model for intestinal barrier (Angelis and Turco, 2011).The protocol described in this article explains the procedure to grow and maintain Caco-2 cells and then infect them to study adhesion and invasion properties of listerial species. ). (A) Paxillin+/+, paxillin/ (mock transfected), or paxillin/ MEFs transfected with GFP-paxillin were infected with SL1344 at a MOI = 30 for 1 h and were subjected to the two-color immunofluorescence assay. Randazzo P. A., Andrade J., Miura K., Brown M. T., Long Y. Q., Stauffer S., Roller P., Cooper J. Salmonella enterica National Library of Medicine 2006 by The American Society for Cell Biology, 31 December 2020 | Epigenetics, Vol. See methods. This fungus has a range of virulence factors that can be potentially relevant to the pathology of periodontal disease, such as the ability to adhere and invade gingival connective tissue [6]. Nikawa et al. MDCK cells infected apically with either the wild-type Salmonella strain SL1344 or the syngeneic entry-deficient mutant VV341(hilA) were lysed and immunoprecipitated with antibody to p130Cas, and the levels of associated FAK or paxillin were determined by immunoblotting. 9, Journal of Biological Chemistry, Vol. (A) MDCK cells were infected apically with S. typhimurium strain SL1344 for 20 min. This kit includes a plate containing one row of each of the 5 substrates. Thermal conditions used for the PCR were 38 cycles at 94C for 1 min, 53C for 1 min and 72C for 30 s. C. albicans isolates were inoculated separately into 15 ml of Sabouraud dextrose (SD) broth (Difco Laboratories Detroit, MI, USA) and incubated overnight at 37C in 5% CO2. Exclusion criteria were; use of antibiotics and periodontal treatment during the previous 6 months, pregnancy, smoking, systemic disease, immunosuppression, clinical manifestation of oral candidosis, the use of partial and/or total prosthesis, the use of an orthodontic apparatus or treatment with any medication that could interfere with the periodontium or the response to periodontal therapy. A cell suspension was prepared in the same buffer to obtain an optical density (A0) of 0.40.6 (at 600 nm). Salmonella entry does not require increased Cas tyrosine phosphorylation, but does require the substrate-binding domain. Adhesion assay is straight forward wherein the bacteria are incubated with Caco-2 cells for 30 min and the bacterial counts for mutants and WT strains are compared to observe any alteration in adhesion properties as a result of mutation. MF-Millipore filters (EMD Millipore, catalog number: SCGPU05RE), Eppendorf tubes (Eppendorf, catalog number: 022363204), Cell culture flasks (Corning, catalog number: 3275), Cell culture plates (12-well cell culture receiver plate, sterile) (EMD Millipore, catalog number: PIMWS1250), Cell scrapers (Corning, catalog number: 3010), ZapCap bottle-top filters, pore size 0.2 m (Maine Manufacturing, catalog number: 10443421), Serological pipettes (1, 5, 10, 25, 50 ml) (Corning, catalog numbers: 4010, 4050, 4100, 4250, 4501), Culture tubes (Sigma-Aldrich, catalog number: T1661), Caco-2 cell line (ATCC, catalog number: HTB-37), 70% ethanol (Fisher Scientific, catalog number: BP82014), Trypsin-EDTA solution (Sigma-Aldrich, catalog number: T3924), Brain Heart Infusion (BHI) agar (Sigma-Aldrich, catalog number: 70138), BHI broth (Sigma-Aldrich, catalog number: 53286), Gentamicin (Sigma-Aldrich, catalog number: G1397), Eagles minimum Essential medium (EMEM) (ATCC, catalog number: 30-2003), Fetal bovine serum, certified, heat inactivated (FBS) (Thermo Fisher Scientific, Gibco, Penicillin-streptomycin (10,000 U/ml) (Thermo Fisher Scientific, Gibco, Dulbeccos phosphate buffered saline (Sigma-Aldrich, catalog number: D8537), Triton X-100 (Sigma-Aldrich, catalog number: 234729), Phosphate-buffered saline, 10x (PBS) (Sigma-Aldrich, catalog number: P5493), Water bath, 37 C (Thermo Fisher Scientific), Biological safety cabinet (Thermo Fisher Scientific, Thermo Scientific, Inverted microscope(Nikon Instruments, model: Eclipse Ti-S), Pipette (Thermo Fisher Scientific, Thermo Scientific, Pipettor (Daigger Scientific, model: Portable Pipet-Aid XP Pipette Controller), Hemacytometer (Fisher Scientific, catalog number: S17040), 37 C incubator (Thermo Fisher Scientific), Fisher Scientific Sonic dismembrator (Fisher Scientific, model: 100), Vortex (Thermo Fisher Scientific, Thermo Scientific, Growing and maintaining Caco-2 cell lines, Using MF-Millipore filters prepare media, Caco-2, human colon adenocarcinoma cells are maintained in cEMEM (complete EMEM, see Recipes), Thaw a vial of frozen Caco-2 cells from ATCC (or previously frozen cells in the lab) by gentle agitation in a 37 C water bath. Rabbit polyclonal anti-1 integrin antibody E63E was kindly provided by D. W. DeSimone (University of Virginia). (A) Percentage (%) of NO in the presence of each Candida albicans strain. Cells maintained in the absence of bacteria were used as controls. Although both proteins have been implicated in the integrin-mediated uptake of other bacterial pathogens, this is the first evidence that FAK can function in this process independently of its kinase activity. A. The new PMC design is here! Rabbit polyclonal anti-FAK antibody A-17 was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). All strains were able to adhere and invade gingival fibroblasts but the HH strains had a greater capacity to adhere and invade cells (Table 1) than LH isolates. This work was supported by grants from the National Institutes of Health (DK58536) and the Crohn's and Colitis Foundation of America (to J.E.C.). (2005) showed that FAK plays an essential role in integrin 15mediated invasion of Staphylococcus. 24 h after seeding, check the cells under microscope for attachment, if attached to flask surface, slowly aspirate media to remove dead cells and add pre-warmed (37 C) cEMEM. Interestingly, as shown in Figure 9, we found that overexpression of Cas was not able to rescue bacterial invasion in FAK/ cells. Although PP2 treatment efficiently inhibited tyrosine phosphorylation of Cas during Salmonella invasion (see Supplementary Material, Figure S3), bacterial internalization remained unaffected under these conditions (Figure 6B). An alpha level of 0.05 was used to determine statistical significance. Reddy et al., 2016 Oral mucosal surfaces are the primary oral reservoirs of these yeasts, followed by both supra and subgingival biofilm [2]. These observations suggest that Salmonella invasion does not induce FAK activation. Surprisingly, bacterial invasion efficiency was actually enhanced in paxillin/ MEFs compared with wild-type cells (Figure 8A). Entry of Salmonella into FAK/ cells is dramatically impaired and can be restored to control levels by expression of wild-type FAK. Listerial colonies are regular white rounded colonies occurring singly or in short chains. However, Salmonella activate Rac directly through the secreted effector protein SopE (Hardt et al., 1998; Criss et al., 2001) and presumably do not require host proteins to perform this function. This assay was performed in duplicate. Each point represents the mean of six replicates; standard error is indicated by error bars. B., Fry J., Rock E. P., Falkow S. Focal adhesion kinase signaling promotes phagocytosis of integrin-bound photoreceptors. 48 h post incubation count bacterial colonies, record and calculate colony forming units. The CSH results ranged from 0.366.20% for the LH and 62.4074.93% for the HH strains (Fig. (C) The bottom panel shows a Cas reconstituted cell with internalized (red) and adhered bacteria (yellow). Then, cells were fixed in 2% paraformaldehyde, and extracellular Salmonella were stained using a rabbit polyclonal antibody against Salmonella LPS (1:500), followed by a Cy2-conjugated goat anti-rabbit antibody (1:400). For FAK, Cas, and paxillin staining, F-actin was labeled with rhodamine-conjugated phalloidin (red); endogenous FAK, Cas, or paxillin were detected with specific monoclonal antibodies, followed by a Cy2-conjugated secondary antibody (green); Salmonella were stained with a polyclonal antibody against bacterial LPS followed by a Cy5-conjugated secondary (blue). Overexpression of FAK rescues Salmonella invasion in Cas/ MEFs. Surprisingly, reconstitution of bacterial internalization requires neither the kinase domain of FAK nor activation of c-Src, but does require a C-terminal PXXP motif through which FAK interacts with Cas. This protocol has been successfully used previously to study the adhesion and invasion properties of listerial strains (Jaradat and Bhunia, 2003; Lecuit, 2005; In addition to the presence of microbial adhesins and receptors on host cells, microbial surface hydrophobicity has been described as an important factor that influences adhesion of microorganisms to biological or inert surfaces [12]. Adherent cells are quantified using either colorimetric or fluorometric detection. 2B). FAK is required for Salmonella internalization. Additionally, this system is useful for studying the production of several products of fibroblasts, e.g., cytokines and nitric oxide, which are related to the progression of inflammation and tissue destruction [10].